By Author
  By Title
  By Keywords

July 2020, Volume 70, Issue 7

Research Article

Association of Pro198Leu polymorphism in glutathione peroxidase one (GPX1) gene with peripheral neuropathy in type 2 diabetic patients

Shabana Mushtaq  ( Department of Biochemistry and Molecular Biology, Army Medical College, Rawalpindi. Pakistan )
Muhammad Javad Yousaf  ( Department of Biochemistry and Molecular Biology, Army Medical College, Rawalpindi. Pakistan. )
Amir Rashid  ( Department of Biochemistry and Molecular Biology, Army Medical College (AMC), Rawalpindi, Pakistan. )
Saleem Ahmed Khan  ( Department of Pathology, Army Medical College, Rawalpindi. Pakistan )
Imran Raza  ( Department of Biochemistry and Molecular Biology, Army Medical College, Rawalpindi. Pakistan. )
Asifa Majeed  ( Department of Biochemistry and Molecular Biology, Army Medical College (AMC), Rawalpindi, Pakistan. )

Abstract

Objectives: To evaluate the association of Pro198Leu polymorphism in glutathione peroxidase 1 gene in type 2 diabetic patients with neuropathy.

Methods: The comparative cross-sectional study was conducted from February 2 to November 30, 2018, at the Department of Biochemistry and Molecular Biology, Army Medical College, Rawalpindi, Pakistan, in collaboration with the Department of Neurology, Military Hospital, Rawalpindi. Diagnosed type 2 diabetics of either genders aged 40-70 years were divided into two equal groups of neuropathy and non- neuropathy subjects. Deoxyribonucleic acid was subjected to restriction fragment length polymorphism for glutathione peroxidase 1gene analysis. Hardy Weinberg equation was used to check the genotype frequency equilibrium.

Results: Of the 60 patients, there were 30(50%) each in the two groups. Age, fasting glucose level and diabetes duration were significantly different between the groups (p<0.05). Even though the frequency of TT genotype was higher, no association of the polymorphism and any of the genotypes was found with diabetic neuropathy (p>0.05).

Conclusion: There was no association found between Pro198 Lue polymorphism in glutathione peroxidase 1 and diabetic neuropathy.

Keywords: Diabetic neuropathy, Glutathione peroxidase, Oxidative stress, Polymorphism, Restricted fragment length polymorphism, RFLP. (JPMA 70: 1182; 2020)

DOI: https://doi.org/10.5455/JPMA.29923

 

Introduction

 

Type 2 Diabetes mellitus (T2DM) is a chronic multifactorial, metabolic syndrome characterised by hyperglycaemia with insulin resistance (IR). It is one the most prevalent metabolic disorder associated with high mortality and morbidity.1 According to the World Health Organisation (WHO), the world diabetic population has increased four times since 1980, reaching 422 million.2 Approximately 1.6 million deaths are caused directly by T2DM and its complications.3 According to the latest survey in 2018, the prevalence of T2DM in Pakistani population is 26.3%.4 Diabetic peripheral neuropathy (DPN) is the most common morbid diabetic complication, affecting about half of the patients and it is often left undiagnosed,5 characterized by pain, loss of sensation and paresthesia. It involves both autonomic and peripheral nerves, resulting in almost 80% non-traumatic leg amputations worldwide.6 Prolonged oxidative ravages can intercede to neuron, Schwan cell and peripheral glial cell apoptosis, causing sensory and motor loss.7 The prevalence of DPN is documented from 14% to 63%; the variation being attributable to the criteria used and population from different ethnic origins.8 Approximately 30% of the diabetic patients in Pakistan suffer from DPN.9 The raised oxidative stress in T2DM is partnered by the constitution of advanced glycation end products (AGEs), provoking dyslipidaemia, inflammation as well as vascular and thrombotic complications.10 Potential molecular driving forces for the augmentation of oxidative stress (OS) are reactive metabolites, like reactive oxygen species (ROS), free radicals peroxides, lipid peroxides and heavy metals.11 In order to combat this phenomenon, nature has provided the human body with certain defence mechanisms which involve the antioxidant enzymes, glutathione peroxidise (GPX), catalase (CAT), superoxide dismutase (SOD), nitric oxide synthase (NOS) and glutathione S transferase (GST).12 GPX1 enzyme is a soluble selenoprotein and the master detoxifier as it reduces free radicals, thereby making them less harmful to body tissues.13 GPX1 is the most common isoform in human cells. GPX1 Pro198Leu polymorphism (rs1050450) causes amino acid to change from proline to leucine at codon 198, affecting enzyme activity.14 This enzyme is encoded by the GPX1 gene which is located at chromosome 3p21. It contains two exons where two alternatively spliced transcript variants encode two isoforms for this gene. There are three genotypes and two alleles, C and T, and genotypes CC, CT and TT.15 Expression of GPX is regulated by transcription factor (TF), nuclear factor erythroid2 (Nrf2) and antioxidant responsive element (ARE).15 The area of genetics in DPN is far less explored compared to other vascular complications of diabetes, such as retinopathy and nephropathy. Up till now about 80 T2DM-susceptible loci in different ethnicities have been documented around the world.5 The current study was planned to explore the role of single-nucleotide polymorphism (SNP) in GPX1 gene and its association with DPN among local patients.

 

Patients and Methods

 

The comparative cross-sectional study was conducted from February 2 to November 30, 2018, at the Department of Biochemistry and Molecular Biology, Army Medical College (AMC), Rawalpindi, Pakistan, in collaboration with the Department of Neurology, Military Hospital (MH), Rawalpindi. Approval from Ethical Review Committee (ERC) of AMC was taken prior to the commencement of study. The sample size was calculated using WHO calculator by taking 30% population proportion,9 95% confidence interval (CI) and 11% absolute precision. Patients were selected using non-probability purposive sampling. Those included were T2DM patients of either gender aged 40-70 years diagnosed by a neuro-physician on the basis of clinical examination, nerve conduction study (NCS), and electromyography (EMG). Non-diabetic neuropathic patients were excluded. After getting informed consent from the subjects, they were divided into two equal groups, with Group I having T2DM patients without neuropathy, and Group II having T2DM patients with neuropathy. Demographic and clinical details were recorded on a structured proforma. Fasting blood samples of 5ml were drawn and stored at 40C, which were later analysed for fasting blood glucose (FBG), glycosylated haemoglobin (HbA1C) and genotypes. Deoxyribonucleic acid (DNA) was extracted from the whole blood by using Thermo scientific DNA purification kit. Extracted DNA samples were analysed for quality and quantity via 1.5% agarose gel electrophoresis (AGE) and stored at -200C. The following primers against the GPX1 gene fragment were designed using National Center for Biotechnology Information (NCBI) primer blast.16 Forward primer: 5'_TTGACATCGAGCCTGACATC_3' Reverse primer: 5'_CAGGTGTTCCTCCCTCGTAG__3' A 161 base pair (bp) fragment of GPX1 gene containing the polymorphic segment was amplified by conventional polymerase chain reaction (PCR). The amplification was confirmed by 1.5% AGE. Genotyping was performed using the analysis of fragment length polymorphism (RFLP) among restriction fragments of amplified products, with hereditary angioedema-III (HEA III) restriction digestion enzyme (Thermo scientific). The polymorphism was visualised by separating the digested fragments via 2.5% AGE on the basis of their size. The respective genotypes were identified according to the digested fragment length (Figure-1).

Data was analysed using SPSS 22. Descriptive statistics were calculated for quantitative variables and compared using independent t test. Categorical variables were presented as frequencies and percentages. Hardy- Weinberg equilibrium (HWE) principle was assessed by using chie-square with one degree freedom to find the association of polymorphic frequencies in the groups. P< 0.05 was considered statistically significant.

 

Results

 

Of the 60 T2DM patients, there were 30 (50%) each in the two groups. In terms of baseline characteristics, age, FBG and T2DM duration were significantly different between the groups (Table). HWE was 8.4 (p=0.03), depicting significant difference in the existence of allelic frequencies. Despite the frequency of TT genotype being higher, there was no association of the polymorphism and any of the genotype with DPN (Figure-2).

 

Discussion

 

To the best of our knowledge, the current study is the first to have conducted genetic analysis of GPX1 gene among DPN patients in Pakistan. It provides insight into GPX1 as a potential molecular risk factor for the onset and prognosis of DPN, which may well be a step towards personalised medicine. The main goal of the study was to find association of Pro198Leu polymorphism in the GPX1 (rs1050450, 198C > T) gene with DPN risk. Although there was increased frequency of T allele and TT genotype in the DPN patients compared to diabetics without DPN, but no association was observed between the studied SNP and DPN as well as TT genotype. Our data coincided with the Hardy-Weinberg principle and genotypic frequency. There was difference in allelic frequency of alleles C and T, showing that our diabetic population exhibited greater chance of genotype CC and CT compared to TT, but the association of this polymorphism with risk of neuropathy was not found (Figure-2). However, the study provided new clinically relevant information regarding genetic determinants of susceptibility to DPN. T2DM duration and FBG levels of the two groups exhibited significant difference. Although HbA1C and body mass index (BMI) showed a difference in the values of the two groups but it was not statistically significant. As T2DM duration was more in DPN patients, they were usually taking hypoglycaemic drugs, which leads to lower glycaemic levels; explaining the non-significant difference (Table).

As perceived from previous researches, the pre-diabetics are more prone to developing DPN compared to the diagnosed diabetics.7,17,18 No significant association between GPX1 Pro198Leu SNP and DPN, myocardial infarction (MI) and stroke was observed by Malazy et al. in their research on polymorphism of antioxidant genes in relation to T2DM management.19 These findings are similar to the results of the current study. In a research on Kurdish population to see the effect of polymorphism in three major antioxidant genes, including manganese superoxide dismutase (MnSOD), CAT and Pro198 Leu polymorphism in GPX1 (rs1050450) in relation to polycystic ovarian syndrome (PCOS), no association was found between the risk of PCOS and Pro198Leu (rs1050450) polymorphism, which is in line with the results of the current study as IR and raised OS are encountered in both cases.14 Kasznicki et al. studied Pro197Leu polymorphism in GPX1gene in T2DM Polish patients with diabetic symmetrical polyneuropathy (DSPN) and reported no association,18,19 which is in line with our study. On the other hand, a study d in Polish population showed significant association of Pro198Leu polymorphism with DPN patients compared to diabetics without DPN. It also observed significant increase in T allele frequency associated with DPN.15 These findings are in coantrast to our results, but the other study found no association of Pro198Leu polymorphism in GPX1 gene when subgroups of patients with cardiovascular disease (CVD) and those without CVD were compared. Hishida et al. studied gene polymorphism in different antioxidant genes including SOD2, CAT, GPX1, thioredoxin reductase (TXNRD), selenoprotein P (SEPP1), 15-kDa selenoprotein (SEP15) and selenoprotein S, (SELS) in reference to kidney disease at stage 2 to 5 demonstrated no significant associations between the GPX1 polymorphisms with chronic kidney disease (CKD) risk20 Yosra et al. conducted a research on Tunisian men suffering from chronic heart disease (CHD) and healthy controls, and showed a lack of association of Pro198Leu GPX1 polymorphism with CHD risk and severity.21 In contrast, Politi et al. examined the association between this gene variant and DPN among diabetic Caucasian subjects and observed that the polymorphism was present more in patients with DPN than in those without DPN.20 The results of this study suggest that the T allele of Pro198Leu (rs1050450) is a risk factor for DPN.22 Two studies elaborated the fact that South Asians have more conserved small nerve fibre function compared to the Europeans, and the amendable risk factors for CHD were the main contributors to these ethnic differences. They suggested that improved autonomic neurogenic control of cutaneous blood flow in Asians may contribute to their protection against foot ulcers.23,24 Another possible reason for the less severe neuropathic effects in South Asian population could be the lower frequency of TT genotype, which is held responsible for DPN by many of the researchers around the world as already mentioned.15,22 Our results also favour this concept as no association was found between DPN and TT genotype in the study population. The association between Pro198Leu polymorphism in GPX1 gene with DPN in different population of a particular ethnicity may show a different effect completely. Hence, it is important to study the polymorphic variants of significant genes in Pakistani population so that the risk genotype/haplotype can be identified. This will help in the identification of susceptible individuals, making them aware of the risks, related complications and preventive measures to delay or avert the disease onset. Due to resource constraints, the sample size was small which is a limitation of the current study.

 

Conclusion

 

There was no association between Pro198Lue polymorphism in GPX1 and DPN. Moreover, no association was found between TT genotype and DPN.

 

Disclaimer: None.

Conflict of Interest: None.

Source of Funding: Research fund for Postgraduate Trainees, National University of Medical Sciences (NUMS), Rawalpindi.

 

References

 

1. Stitt AW, Curtis TM, Chen M, Medina RJ, McKay GJ, Jenkins A, et al. The progress in understanding and treatment of diabetic retinopathy. Prog Retin Eye Res 2016;51:156-86. doi: 10.1016/j.preteyeres.2015.08.001.

2. Picu A, Petcu L, ?tefan S, Mitu M, Lixandru D, Ionescu-Tirgovi?te C, et al. Markers of Oxidative Stress and Antioxidant Defense in Romanian Patients with Type 2 Diabetes Mellitus and Obesity. Molecules 2017;22:e714. doi: 10.3390/molecules22050714.

3. Nazarian-Samani Z, Sewell RDE, Lorigooini Z, Rafieian-Kopaei M. Medicinal Plants with Multiple Effects on Diabetes Mellitus and Its Complications: a Systematic Review. Curr Diab Rep 2018;18:72. doi: 10.1007/s11892-018-1042-0.

4. Basit A, Fawwad A, Qureshi H, Shera AS. Prevalence of diabetes, pre-diabetes and associated risk factors: second National Diabetes Survey of Pakistan (NDSP), 2016-2017. BMJ Open 2018;8:e020961. doi: 10.1136/bmjopen-2017-020961.

5. Spallone V. Might genetics play a role in understanding and treating diabetic polyneuropathy? Diabetes Metab Res Rev 2017;33. doi: 10.1002/dmrr.2882.

6. Chawla A, Chawla R, Jaggi S. Microvasular and macrovascular complications in diabetes mellitus: Distinct or continuum? Indian J Endocrinol Metab 2016;20:546-51. doi: 10.4103/2230- 8210.183480.

7. Feldman EL, Nave KA, Jensen TS, Bennett DLH. New Horizons in Diabetic Neuropathy: Mechanisms, Bioenergetics, and Pain. Neuron 2017;93:1296-1313. doi: 10.1016/j.neuron.2017.02.005.

8. Davoudi S, Sobrin L. Novel Genetic Actors of Diabetes-Associated Microvascular Complications: Retinopathy, Kidney Disease and Neuropathy. Rev Diabet Stud 2015;12:243-59. doi: 10.1900/RDS.2015.12.243.

9. Gul I, Gul S, Dar MA, Ali A, Ashraf A, Qadri S. Prevalence of peripheral neuropathy and pattern of involvement on nerve conduction study in patients of type 2 diabetes mellitus with clinical symptoms of peripheral neuropathy in kashmiri population a hospital based study. Imp J Interdiscip Res 2017;3:909-15 .

10. Soares JP, Silva AM, Fonseca S, Oliveira MM, Peixoto F, Gaivao I, et al. How can age and lifestyle variables affect DNA damage, repair capacity and endogenous biomarkers of oxidative stress? Exp Gerontol 2015;62:45-52. doi: 10.1016/j.exger.2015.01.001.

11. Kayama Y, Raaz U, Jagger A, Adam M, Schellinger IN, Sakamoto M, et al. Diabetic Cardiovascular Disease Induced by Oxidative Stress. Int J Mol Sci 2015;16:25234-63. doi: 10.3390/ijms161025234.

12. Verma S, Sagar N, Vats P, Shukla KN, Abbas M, Banerjee M. Antioxidant enzyme levels as markers for type 2 diabetes mellitus. Int J Bioassays. 2013;2:685-90.

13. Nimse SB, Pal D. Free radicals, natural antioxidants, and their reaction mechanisms. RSC Adv 2015;5:27986-28006. DOI: 10.1039/C4RA13315C

14. Salahshoor MR, Sohrabi M, Jalili F, Jalili P, Rezavand N, Haghnazari L, et al. No evidence for a major effect of three common polymorphisms of the GPx1, MnSOD, and CAT genes on PCOS susceptibility. J Cell Biochem 2018. doi: 10.1002/jcb.27564. [Epub ahead of print]

15. Buraczynska M, Buraczynska K, Dragan M, Ksiazek A. Pro198Leu Polymorphism in the Glutathione Peroxidase 1 Gene Contributes to Diabetic Peripheral Neuropathy in Type 2 Diabetes Patients. Neuromolecular Med 2017;19:147-53. doi: 10.1007/s12017-016- 8438-2.

16. National Center for Biotechnology Information USNLoM. NCBI Primer BLAST USA: NIH: Primer Designing Tool. [Online] [Cited 2018 November 30]. Available from URL: https://www.ncbi.nlm.nih.gov/tools/primer-blast/.

17. Pop-Busui R, Boulton AJ, Feldman EL, Bril V, Freeman R, Malik RA, et al. Diabetic Neuropathy: A Position Statement by the American Diabetes Association. Diabetes Care 2017;40:136-54. doi: 10.2337/dc16-2042.

18. Stino AM, Smith AG. Peripheral neuropathy in prediabetes and the metabolic syndrome. J Diabetes Investig 2017;8:646-55. doi: 10.1111/jdi.12650.

19. Tabatabaei-Malazy O, Khodaeian M, Bitarafan F, Larijani B, M Amoli M. Polymorphisms of Antioxidant Genes as a Target for Diabetes Management. nt J Mol Cell Med 2017;6:135-47. doi: 10.22088/acadpub.BUMS.6.3.135.

20. Hishida A, Okada R, Naito M, Morita E, Wakai K, Hamajima N, et al. Polymorphisms in genes encoding antioxidant enzymes (SOD2, CAT, GPx, TXNRD, SEPP1, SEP15 and SELS) and risk of chronic kidney disease in Japanese - cross-sectional data from the J-MICC study. J Clin Biochem Nutr 2013;53:15-20. doi: 10.3164/jcbn.13-17.

21. Souiden Y, Mallouli H, Meskhi S, Chaabouni Y, Rebai A, Cheour F, et al. MnSOD and GPx1 polymorphism relationship with coronary heart disease risk and severity. Biol Res 2016;49:22. doi: 10.1186/s40659-016-0083-6.

22. Politi C, Ciccacci C, D'Amato C, Novelli G, Borgiani P, Spallone V. Recent advances in exploring the genetic susceptibility to diabetic neuropathy. Diabetes Res Clin Pract 2016;120:198-208. doi: 10.1016/j.diabres.2016.08.006.

23. Almuhannadi H, Ponirakis G, Khan A, Malik RA. Diabetic neuropathy and painful diabetic neuropathy: Cinderella complications in South East Asia. J Pak Med Assoc 2018;68:85-9.

24. Fadavi H, Tavakoli M, Foden P, Ferdousi M, Petropoulos IN, Jeziorska M, et al. Explanations for less small fibre neuropathy in South Asian versus European subjects with type 2 diabetes in the UK. Diabetes Metab Res Rev 2018;34:e3044. doi: 10.1002/dmrr.3044.

 

Journal of the Pakistan Medical Association has agreed to receive and publish manuscripts in accordance with the principles of the following committees: